spike in template r Search Results


90
plexon inc online template-matching spike discriminator (sortclient
Online Template Matching Spike Discriminator (Sortclient, supplied by plexon inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike+in+template+r/online+template+matching+spike+discriminator++map+omniplex+system/pmc11295024-222-8-11
Average 90 stars, based on 1 article reviews
online template-matching spike discriminator (sortclient - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
PrimerDesign Inc internal control template dna (spike dna)
Internal Control Template Dna (Spike Dna), supplied by PrimerDesign Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike+in+template+r/internal+control+template+dna++spike+dna+/pm22294771-86-10-21
Average 90 stars, based on 1 article reviews
internal control template dna (spike dna) - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
FluidX Inc rna spike-in template mixture
Rna Spike In Template Mixture, supplied by FluidX Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike+in+template+r/rna+spike+in+template+mixture/pm36555301-262-32-11
Average 90 stars, based on 1 article reviews
rna spike-in template mixture - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

90
BIOHELIX corp spike-in-template dna
Spike In Template Dna, supplied by BIOHELIX corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike+in+template+r/spike+in+template+dna/pm22702360-38-4-34
Average 90 stars, based on 1 article reviews
spike-in-template dna - by Bioz Stars, 2026-10
90/100 stars
  Buy from Supplier

86
Sangon Biotech spike in template f
Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel <t>shows</t> <t>spike-in</t> RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.
Spike In Template F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/spike+in+template+r/f+in+spike+template/pmc13142104-80-0-10
Average 86 stars, based on 1 article reviews
spike in template f - by Bioz Stars, 2026-10
86/100 stars
  Buy from Supplier

Image Search Results


Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Journal: STAR Protocols

Article Title: Protocol to produce and apply barcoded rabies virus for single-neuron input mapping in mice

doi: 10.1016/j.xpro.2026.104537

Figure Lengend Snippet: Workflow for barcode amplicon library preparation This figure summarizes the workflow for barcode amplicon library preparation in this part. The left panel shows barcode enrichment from scRNA-seq cDNA by two rounds of PCR, followed by bead purification and quality control to generate the final Illumina barcode library. The middle panel shows spike-in RNA preparation, including spike-in template assembly, purification, in vitro transcription, DNA digestion, RNA purification, and quality control. The right panel shows input region library preparation, including reverse transcription, pooling and purification, pre-amplification PCR, and quality control to generate the final Illumina input-region library. Step numbers in red correspond to the detailed protocol steps.

Article Snippet: Spike-In template F , TAATACGACTCACTATAGGGAGTGAC AATGAAACCTACGTAGTGCAAAGAGA AGTGGCAGTTGCCAAATACAGCAACC TTGGTGGTGGCATGGACGAGCTGTAC AAGTAAGGTACCGGCCAT , Sangon Biotech.

Techniques: Amplification, Purification, Control, In Vitro, Reverse Transcription